Article
pubs.acs.org/biochemistry

The Robustness of the Escherichia coli Signal-Transducing UTase/URPII Covalent Modification Cycle to Variation in the PII Concentration
Requires Very Strong Inhibition of the UTase Activity of UTase/UR by
Glutamine
Peng Jiang,† Yaoping Zhang,‡,§ Mariette R. Atkinson,† and Alexander J. Ninfa†,*
†

Department of Biological Chemistry, University of Michigan Medical School, Ann Arbor, Michigan 48109-0606, United States
Department of Bacteriology, University of WisconsinMadison, Madison, Wisconsin 53706, United States

‡

S Supporting Information
*

ABSTRACT: Uridylyltransferase/uridylyl-removing enzyme (UTase/UR) catalyzes
uridylylation of PII and deuridylylation of PII-UMP, with both activities regulated by
glutamine. In a reconstituted UTase/UR-PII cycle containing wild-type UTase/UR, the
steady-state modification of PII varied from nearly complete modification to nearly
complete demodification as glutamine was varied, whether the level of PII was saturating
or unsaturating, but when a His-tagged version of UTase/UR was used, the robustness to
variations in PII concentration was lost and the range of PII modification states in
response to glutamine became smaller as the PII concentration increased. The presence
of the His tag on UTase/UR did not alter PII substrate inhibition of the UT activity and
had little effect on the level of the UT activity but resulted in a slight defect in UR
activity. Importantly, at high PII concentrations, glutamine inhibition of the UT activity
was incomplete. We hypothesized that binding of PII to the UR active site in the HD
domain was responsible for PII substrate inhibition of the UT activity and, in the Histagged enzyme, also weakened glutamine inhibition of the UT activity. Consistent with
this, three different UTase/UR proteins with HD domain alterations lacked substrate inhibition of UT activity by PII; in one
case, the HD alteration eliminated glutamine regulation of UT activity, while for the other two proteins, alterations of the HD
domain ; partially compensated for the effect of the His tag in restoring glutamine regulation of UT activity. We conclude that very
strong inhibition of UT activity was required for the UTase/UR-PII cycle to display robustness to the PII concentration, that in
the wild-type enzyme PII brings about substrate inhibition of the UT activity by binding to the HD domain of the enzyme, and
that addition of an N-terminal His tag resulted in an altered enzyme with subtle changes in the interactions between domains
such that binding of PII to the HD domain interfered with glutamine regulation of the UT domain.

B

producing an output signal in response to stimulation are the
concentrations of proteins and small molecules that comprise
the system, and the activities and regulatory properties of the
proteins. Some cellular signaling systems are experimentally
demonstrated to display robustness to some or all of these
parameters,3,4 and theoretical work argues that such robustness
may be a general property of cellular signaling systems and, in
particular, the many systems that must function over a broad
range of conditions.5 However, some systems may have
specifically evolved to limit robustness to variation of a
parameter, to allow that parameter to control the shifting of
the system between regulatory regimes. The opposite of a
robust system is a fine-tuned one, where the output of the
system in response to stimulation depends upon the values of
the parameters of the system. Of course, “robustness” and “finetuning” are human concepts, and in nature, we expect systems

iological signal transduction systems must produce an
accurate output signal in response to an input stimulation
in the heterogeneous and stochastic environment of the cell,
where variations in the concentrations of proteins and small
molecules that comprise the system as well as in the
concentrations of the proteins and small molecules external
to the system are routinely experienced. In addition to
fluctuations in concentration, the enzymatic activities of the
proteins of a system may experience fluctuations because of
genetic mutations, regulatory covalent modifications, or
alternative cellular localizations. Robustness is becoming
recognized as an important property of biological systems
and in particular biological signal transduction systems;
robustness is defined as the property that allows a system to
maintain its functions in the face of external and internal
perturbations.1,2 The property of robustness always pertains to
specific parameters of the system, and system function may be
highly robust to changes in certain parameters while remaining
fragile to changes in other parameters. For a signaling system,
physiologically important parameters that affect the process of
© 2012 American Chemical Society

Received: May 2, 2012
Revised: October 22, 2012
Published: October 23, 2012
9032

dx.doi.org/10.1021/bi3005736 | Biochemistry 2012, 51, 9032−9044

Biochemistry

■

to have intermediate properties. For example, system function
may tolerate variations of parameters within some limits but be
unable to tolerate extreme values such as null.
A common motif of signal transduction systems is the
covalent modification cycle, in which the substrate protein of
the cycle is subjected to reversible covalent modification that
controls its activities. The enzymes that catalyze the
modification and demodification of this substrate protein,
termed the converter enzymes of the cycle, produce an output
signal (the level of the modified substrate protein) in response
to a stimulation that regulates one or both converter enzymes.
Given the ubiquitous occurrence of covalent modification
cycles in nature and their importance in central physiological
processes, considerable effort has been focused on theoretical
and experimental studies of the signal processing properties of
such systems, including studies of signal amplification,6 noise
filtering,7 and factors affecting sensitivity.8−10 In this paper, we
will demonstrate how a kinetic parameter of the converter
enzymes, specifically the effectiveness of the inhibition of one of
the converter enzymes, eliminated the robustness of a
reconstituted covalent modification cycle toward the concentration of its substrate protein. Furthermore, we were able to
document the regulatory catastrophe as the cycle substrate
protein concentration was increased beyond the range over
which effective signaling occurred, provisionally providing a
diagnostic phenotype for the loss of robustness.
The PII-UTase/UR covalent modification cycle is part of two
bicyclic cascade systems in Escherichia coli that participate in the
regulation of nitrogen assimilation (reviewed in ref 11). The
PII-UTase/UR-ATase-GS cascade controls the activity of
glutamine synthetase (GS) by reversible covalent adenylylation,
while the PII-UTase/UR-NRII-NRI cascade controls the
phosphorylation state of enhancer-binding transcription factor
NRI (NtrC) and, by so doing, regulates the initiation of
transcription of nitrogen-regulated genes. In both cascades, the
role of the PII-UTase/UR cycle is to communicate the
intracellular concentration of glutamine, sensed by UTase/
UR, via changes in the uridylylation state of PII. Prior studies of
the PII-UTase/UR cycle have revealed the kinetic mechanisms
of the UTase and UR activities, elucidated specificity and
inhibition constants, established the kinetic mechanism for
inhibition by glutamine, and localized the UTase, UR, and
glutamine binding activities to specific domains of the
protein.12,13 Our initial observation of the loss of robustness
due to alteration of a kinetic parameter of a converter enzyme
was quite fortuitous. We examined a His-tagged version of the
bifunctional UTase/UR enzyme and were surprised to observe
that it had a behavior dramatically different than that of the
untagged protein: the His-tagged converter enzyme functioned
effectively only in a reconstituted covalent modification cycle
when the PII substrate protein concentration of the cycle was
very low but not when the PII concentration was high.
Comparison of His-tagged and wild-type UTase/UR then
revealed which kinetic parameter was responsible for robustness of the system to changes in the concentration of its
substrate protein. Further studies using His-tagged enzymes
with additional alterations then allowed us to present and test a
hypothesis for how the activities of the wild-type enzyme were
regulated by the stimulatory effector and how this regulation
was defective in the His-tagged enzyme.

Article

MATERIALS AND METHODS

Purified Proteins. The preparations of PII, wild-type
UTase/UR, and His-tagged UTase/UR prepared from strain
UQ5516 described previously were used.13−15 A second Histagged but otherwise wild-type UTase/UR enzyme preparation
was obtained (from strain SA1) by metal chelate chromatography as described previously,13 followed by fractionation on a
300 mL Biogel A1.5 M gel filtration column equilibrated in 50
mM Tris-HCl (pH 7.5), 0.1% EDTA, and 10% (v/v) glycerol.
The purified enzyme was dialyzed into storage buffer that was
the same as the chromatography buffer, except with 50% (v/v)
glycerol. For the sake of clarity, we will distinguish the two
different preparations of His-tagged UTase/UR by referring to
the strain from which the enzyme was prepared (UQ5516 or
SA1). In Figure S1 of the Supporting Information, the
appearance after sodium dodecyl sulfate−polyacrylamide gel
electrophoresis of wild-type UTase/UR and each of the Histagged but otherwise wild-type enzymes is shown. Each of these
enzymes is approximately 90% pure as judged by visual
inspection of the gels. Importantly, the purified enzymes do not
appear to be contaminated with ATPases or other activities that
interfere with the UT or UR assays (see below). The Histagged enzymes with alterations in the HD domain [HD-AA
(H514A and D515A, from strain UQ5628), HD-QN (H514Q
and D515N, from strain UQ5629), and D-HD (Δ-A510−
D531, from strain UQ5627)] were also described previously.13
Construction and Purification of the D107N Altered
Form of UTase/UR. EcoRI and NdeI restriction sites were
introduced upstream and a BamHI site was introduced
downstream of the glnD gene by polymerase chain reaction
of plasmid pDOP,15 using upstream primer CCCGAATTCATATGAATACCCTTCCAGAACAGTAC and downstream
primer GGAATTCGGATCCCTGACGTACCGCCGCTGGTGGCCA. The amplified glnD gene was cloned into pSelect
(Promega), forming pSelect-glnD, and this plasmid was
mutagenized with the GACGTCAATTTACTGATTTTAAGCCG oligonucleotide. After mutagenesis, the ClaI/NsiI fragment of the mutagenized gene was swapped for the
corresponding wild-type fragment in plasmid pglnD9,15 and
then the whole of the mutated glnD gene was cloned as an
NdeI/EcoRI fragment into NdeI/EcoRI-cleaved pJLA503,16
resulting in pDOP-D107N. The altered UTase/UR-D107N
protein was purified using the same methods that were used for
wild-type UTase/UR.15
Reconstituted UTase/UR-PII Monocycle. The steadystate levels of PII uridylylation at various glutamine
concentrations were measured as described previously.14
Briefly, reaction conditions included 100 mM Tris-HCl (pH
7.5), 25 mM MgCl2, 100 mM KCl, 0.3 mg/mL bovine serum
albumin, 1 mM DTT, 0.5 mM ATP, 0.2 mM α-ketoglutarate,
0.5 mM [α-32P]UTP, and PII and UTase/UR as indicated.
Components except ATP and UTP were combined and
prewarmed at 30 °C for 2 min, and reactions were started by
addition of a prewarmed mixture containing ATP and UTP.
Samples were removed at various times and spotted onto
Whatman P81 phosphocellulose filters, which were washed in
5% TCA, dried, and counted by liquid scintillation spectroscopy. Where indicated, AMP-PNP was used in place of ATP.
For the determination of steady-state values, long time courses
(generally 90 min) were used, and steady states were estimated
by averaging values at the latter time samples (generally four
samples removed between the 30 and 90 min points of
9033

dx.doi.org/10.1021/bi3005736 | Biochemistry 2012, 51, 9032−9044

Biochemistry

Article

Figure 1. His-tagged version of UTase/UR that was defective in steady-state glutamine signaling in reconstituted PII-UTase/UR covalent
modification cycles. (A) Steady-state glutamine responses of reconstituted cycles. Experiments were conducted as described in Materials and
Methods, and the steady-state levels of PII modification at various glutamine concentrations are shown, stated in terms of the number of modified
subunits per tetramer: (□) 36 μM PII and 1.2 μM wt UTase/UR, (○) 0.5 μM PII and 0.02 μM wt UTase/UR, (▼) 36 μM PII and 1.2 μM Histagged UTase/UR (UQ5516), (▲) 3 μM PII and 0.1 μM His-tagged UTase/UR (UQ5516), (■) 0.5 μM PII and 0.017 μM His-tagged UTase/UR
(UQ5516), and (●) 0.2 μM PII and 0.0067 μM His-tagged UTase/UR (UQ5516). Values plotted on the y axis were obtained in the absence of
glutamine. (B) Approach to the steady state in reconstituted systems containing 10 mM glutamine. All systems contained 36 μM PII and 1.2 μM
enzyme: (●) wt UTase/UR, (▲) His-tagged UTase/UR (UQ5516), and (■) His-tagged UTase/UR (SA1). (C) Response of reconstituted covalent
modification cycles to the addition of glutamine. Systems contained 3 μM PII and 0.2 μM enzyme. For the first 10 min, systems were incubated in
the absence of glutamine, after which glutamine was added to a final concentration of 3 mM: (●) wt UTase/UR and (■) His-tagged UTase/UR
(SA1).

MgCl2, 100 mM KCl, 0.3 mg/mL bovine serum albumin, 1 mM
(or as indicated) α-ketoglutarate, 0.5 mM ATP or AMP-PNP,
as indicated, and glutamine and PII-UMP as indicated. Reaction
mixtures were incubated in the absence of PII-UMP for 2 min,
and reactions were initiated by addition of prewarmed PIIUMP. Samples were removed at various times and spotted onto
Whatman P81 phosphocellulose filters, which were washed in
5% TCA, dried, and counted by liquid scintillation spectroscopy.
The catalytic rates measured in the standard UR assay were
observed to depend upon enzyme concentration; the higher the
enzyme concentration, the lower the apparent UR kcat in the
assay (Figure S2 of the Supporting Information). Furthermore,
the assay was variable from day to day, as it was very difficult to
provide the substrate PII-UMP at an identical concentration
and in an identical modification state. Because of this,
meaningful comparisons could be made only in experiments
where UR rates were measured side by side at the same enzyme
concentration, as we did in this study. This deficiency in the
assay is likely due to underestimation of the initial reaction
rates; the assay is based upon watching the labeled substrate
become unlabeled, and consequently, a significant fraction of
the substrate is converted in the assay.
To attempt to obtain more accurate initial rates in the UR
assay, we used a thin-layer chromatography method to separate
PII-UMP from UMP. This procedure allowed us to measure
the product of the UR reaction (UMP) as opposed to simply
measuring the disappearance of the PII-UMP substrate in the
standard UR assay method. For the TLC-based assay method,
reaction conditions were as in the standard UR assay, and 4 μL
samples were removed at various times and immediately mixed
with 1 μL of 0.5 mM EDTA to stop the reaction. After all
samples had been collected, 1 μL aliquots were spotted onto
Cellulose PEI thin-layer chromatography plates (J. T. Baker,

incubation), when the level of PII uridylylation had achieved a
constant value. The steady states observed in this work were
quite stable. This indicated that the purified proteins were not
contaminated by cellular ATPase activity, as depletion of ATP
from the reaction mixtures would result in changing levels of
PII uridylylation.22
Measurement of UT Activity. The initial rate of PII
uridylylation was measured as described previously,14 and the
conditions included 100 mM Tris-HCl (pH 7.5), 25 mM
MgCl2, 100 mM KCl, 0.3 mg/mL bovine serum albumin, 0.5
mM ATP or AMP-PNP, as indicated, UMP as indicated, and
0.5 mM [α-32P]UTP. Reaction mixtures lacking ATP (or AMPPNP) and UTP were incubated for 2 min at 30 °C, and the
uridylylation reactions were started by addition of a prewarmed
mixture of ATP (or AMP-PNP) and UTP. Samples were
removed at various times and spotted onto Whatman P81
phosphocellulose filters, which were washed in 5% TCA, dried,
and counted by liquid scintillation spectroscopy. The UT
catalytic rate was observed to be almost independent of the
enzyme concentration, when it was varied from 0.01 to 1.0 μM,
as long as the level of PII was saturating (Figure S2 of the
Supporting Information); all of the experiments in this paper
were performed within this enzyme concentration range. The
assay is accurate because the product can be made highly
radioactive and is easily meaured when only a tiny amount of
the substrate has been converted, allowing good estimation of
initial rates.
Measurement of UR Activity. PII-[ 32 P]UMP was
prepared as described previously;14 briefly, this involved
extended incubation of PII with UTase/UR in the absence of
glutamine followed by brief heating at 60 °C to inactivate
UTase/UR. The initial rate of deuridylylation of PII-UMP was
examined at 30 °C as described previously,14 in reaction
mixtures that contained 100 mM Tris-HCl (pH 7.5), 25 mM
9034

dx.doi.org/10.1021/bi3005736 | Biochemistry 2012, 51, 9032−9044

Biochemistry

Article

2.69 to 2.73. Because PII is a homotrimer and UTase/UR is a
monomer, at this ratio of substrate to enzyme there were 90 PII
modification sites for every converter enzyme active site. The
range of PII modification states was only slightly diminished
when the PII concentration was 0.5 μM (low value) and the
UTase/UR concentration was 0.02 μM, in which case the range
of uridylylation states was ∼2.59 (Figure 1A). At this substrate
to enzyme ratio, there were 75 substrate sites per converter
enzyme active site. In four repeats of the experiment under
these conditions, and in one additional experiment where the
PII concentration was at 0.5 μM and the UTase/UR
concentration was 0.05 μM, the range of uridylylation states
was again found to be quite consistent, varying between 2.53
and 2.61.
The two conditions noted so far were chosen to ensure that
both ultrasensitive and hyperbolic regimes were sampled
(Figure 1A), and the variation of conditions discernibly shifted
the midpoint of the response, as expected.17 These differences
notwithstanding, a wide range of steady-state uridylylation
states was consistently obtained in response to changes in the
glutamine concentration, regardless of whether the PII
concentration was high or low.
A His-Tagged Version of UTase/UR Displayed an
Altered Response to Glutamine in Reconstituted Monocycles. We examined two different preparations of a Histagged version of UTase/UR that were produced by cloning the
glnD structural gene into common expression vector pET15b.13
The two preparations of the enzyme were made in our two
laboratories, using slightly different procedures (Materials and
Methods). For our studies, we conducted experiments shown
here with both enzyme preparations, which behaved the same
and are mentioned by the strain that served as the source of the
enzyme: UQ5516 (Wisconsin) and SA1 (Michigan). The
altered form of the enzyme resulting from expression from
pET15b contains the sequence Met-Gly-Ser-Ser-His-His-HisHis-His-His-Ser-Ser-Gly-Leu-Val-Pro-Arg-Gly-Ser-His added to
the N-terminus of the protein. The His-tagged UTase/UR
(UQ5516), when used at 1.2 μM, provided a very shallow
response to glutamine when the PII concentration was 36 μM,
and the midpoint of the response was shifted to a significantly
higher glutamine concentration, relative to the results obtained
with the wild-type enzyme under the same conditions (Figure
1A). In this experiment, a narrow range of uridylylation states
(∼1.1) signaled glutamine concentration, and this narrow range
was biased toward high uridylylation states. Using the Histagged UTase/UR UQ5516 enzyme preparation, we also
examined three other conditions where the ratio of PII
modification sites to enzyme active sites was also 90:1,
specifically, systems where the enzyme concentration was 0.1
μM and where the PII concentration was 3 μM, where the
enzyme concentration was 0.017 μM and the PII concentration
was 0.5 μM, and where the enzyme concentration was 0.0067
μM and the PII concentration was 0.2 μM (Figure 1A). In the
system where the PII concentration was 3 μM, a wider range of
uridylylation states signaled glutamine concentration (∼2.1)
than when the PII concentration was 36 μM, and when the PII
concentration was 0.5 and 0.2 μM, a still wider range of
uridylylation states signaled the glutamine concentration
(∼2.4), almost equal to the range obtained when wild-type
UTase/UR (lacking the His tag) was used (Figure 1A). These
results suggested that the absolute PII concentration was the
important parameter controlling the range of uridylylation
states obtained, and not the ratio of PII to the enzyme (which

Inc.), and plates were developed using 0.2 M KPi (pH 8.0) as
the solvent. [Prior to the samples being spotted, the positions
where samples would be spotted were marked lightly with a
pencil, and each plate was chromatographed in water, dried
briefly in air, and spotted with 1 μL of a mixture of UTP, UDP,
and UMP (30 mM each) that served as a carrier and to indicate
the position of UMP.] After development, plates were dried in
air and visualized under a hand-held UV light, and the positions
of the UMP spots were marked with a pencil. A typical
chromatogram that had been marked with a pencil to indicate
the nucleotide spots and then subjected to autoradiography is
shown in Figure S3 of the Supporting Information. The origin
(containing PII-UMP) and the UMP spots were cut from the
plates, and the slices were counted by liquid scintillation
counting. The fraction of counts appearing in the UMP spot
relative to the origin spot was used to calculate the
concentration of UMP. This assay method had the advantage
that the product of the UR reaction was measured directly, and
therefore, it was possible to determine initial rates under
conditions where only a small fraction of the initial substrate
had been converted. Higher initial rates of catalysis were
observed using this method versus the standard assay
procedure, which we attribute to the improved estimation of
the initial reaction velocities (Figure S2 of the Supporting
Information). This TLC-based assay method also showed a
dependence of UR catalytic rate on enzyme concentration;
while similar kcat values were obtained at 0.01 and 0.1 μM
enzyme, much lower than expected kcat values were obtained
when the enzyme was 1 μM (Figure S2C of the Supporting
Information). Consequently, this UR assay method was also
suitable for only side-by-side comparisons of different enzyme
samples at identical enzyme concentrations.

■

RESULTS
The UTase/UR-PII Covalent Modification Cycle Is
Robust to Changes in the PII Concentration. Using
purified proteins, we studied the responses of the UTase/URPII cycle to glutamine in systems that contained different
concentrations of PII and UTase/UR. We show elsewhere that
good glutamine signaling properties were obtained when 100
μM PII was used, the highest concentration we were able to
provide, and that fairly low enzyme concentrations did not
prevent effective signaling, although when the enzyme
concentration was low relative to that of PII, the reaction
mixtures had to be incubated for a very long time to obtain the
steady-state level of PII uridylylation.17 We will also show
elsewhere that variation of PII and enzyme concentrations
alters the sensitivity of responses and the midpoint of
responses;17 such effects are well-known in theory.8−10,18 For
the purposes of this study, we focus on a fairly narrow range of
PII concentrations at which the wild-type system displayed
excellent responsiveness to glutamine (Figure 1A). PII is a
homotrimeric protein that can be reversibly modified at a
unique site (Y51) on each subunit, such that its modification
state can range from zero to three modifications per trimer.
When the PII concentration was 36 μM and the UTase/UR
concentration was 1.2 μM, the PII modification state went from
2.99 uridylyl groups in the absence of glutamine to 0.26 uridylyl
group per trimer in the presence of 10 mM glutamine (Figure
1A); therefore, the range of modification states sampled during
this transition was ∼2.73 of a possible range of 3. This range
was highly reproducible; in four additional repeats of the
experiment, the range of PII modification states varied from
9035

dx.doi.org/10.1021/bi3005736 | Biochemistry 2012, 51, 9032−9044

Biochemistry

Article

Figure 2. Comparison of steady-state PII modification levels in reconstituted covalent modification cycles containing wild-type or His-tagged
UTase/UR. Results of experiments from which glutamine was absent are shown with filled bars; results of experiments in which the glutamine
concentration was 10 mM are shown with empty bars. (A) Results for systems containing wild-type UTase/UR. (B) Results for systems containing
His-tagged UQ5516 UTase/UR. Experiments for panels A and B for each concentration of PII were performed side by side as described in the text.
To maintain a fixed ratio of PII to catalytic sites in the set of experiments, when the PII concentration was 36 μM, the UTase/UR concentration was
1.2 μM; when the PII concentration was 3 μM, the UTase/UR concentration was 0.1 μM; when the PII concentration was 0.5 μM, the UTase/UR
concentration was 0.017 μM; and when the PII concentration was 0.2 μM, the UTase/UR concentration was 0.0067 μM. (C) Result of combining
wild-type and His-tagged enzymes. The PII concentration was 36 μM, and wt and/or His-tagged enzymes were present at 1.2 μM each, as indicated.
(D) Steady-state levels of PII uridylylation in systems where AMP-PNP was present instead of ATP. Experiments were conducted as described for
panel A and panel B, where the PII concentration was 36 μM and the UTase/UR concentration was 1.2 μM, except that ATP was replaced by 0.5
μM AMP-PNP.

was fixed at 90:1). In addition to affecting the range of
uridylylation states obtained in response to glutamine variation,
the PII concentration also controlled the midpoint of the
glutamine response (Figure 1A).
The experiments presented in Figure 1A using wild-type and
His-tagged UTase/UR were performed on different occasions,
and because of the complexity of the experiments, it is highly
desirable to have side-by-side comparisons performed under
identical conditions. In Figure 1B, we show the approach to the
steady state in side-by-side experiments for systems containing
10 mM glutamine, 36 μM PII, and 1.2 μM enzyme (90:1 ratio
of PII modification sites to UT and UR active sites). When the
wild-type enzyme was used, a low PII uridylylation-state level
was obtained, whereas when the His-tagged enzymes were
used, a high PII uridylylation-state level was obtained (Figure
1B). His-tagged UTase/UR prepared from strain SA1 resulted
in slightly higher PII uridylylation-state levels than when Histagged UTase/UR prepared from strain UQ5516 was used, and

this behavior was consistently obtained, as shown in the
experiments to follow and numerous additional experiments.
Differences of this magnitude were also obtained in activity
measurements of wild-type UTase/UR preparations made on
different occasions and probably reflect differences in the loss of
activity during purification (Figure S4 of the Supporting
Information). The high steady-state levels of PII uridylylation
obtained with the His-tagged enzymes in the presence of 10
mM glutamine are consistent with the results from Figure 1A.
In another experiment using reconstituted covalent modification cycles, we explored the effect of allowing the systems
to reach the steady state in the absence of glutamine, such that
PII was highly uridylylated, and then adding glutamine to 3
mM, a concentration expected to result in an intermediate level
of PII uridylylation (Figure 1B). For these experiments, the
trimeric PII concentration was 3 μM and the enzyme
concentration was 0.2 μM, such that the ratio of substrate to
catalytic sites was 45:1. When the system contained wild-type
9036

dx.doi.org/10.1021/bi3005736 | Biochemistry 2012, 51, 9032−9044

Biochemistry

Article

defect in the ability of glutamine to inhibit the UT activity of
the enzyme. Such defects could result in elevated levels of PII
modification states in the presence of glutamine. However, the
mechanism for explaining this defect must also account for its
dependence on the PII concentration at a fixed ratio of PII to
enzyme.
The two activities of the UTase/UR enzyme are of
disproportionate strength; the UT activity has a kcat of ∼144
min−1 in the absence of glutamine, while the UR activity
displays a kcat of only ∼6 min−1 in the presence of 10 mM
glutamine, when measured in our standard assay.12 Furthermore, the UR activity has a basal kcat of ∼2 min−1 in the
absence of glutamine, such that it is only regulated ∼3-fold by
glutamine.12 By contrast, the UT activity is strongly inhibited
by glutamine;12 we show later in this paper that under the
conditions of the experiments performed here we realized
∼100-fold inhibition. In the course of our work, we observed
that the UR activity of UTase/UR was increased when ATP in
the reaction mixtures was replaced by AMP-PNP (Figure S5 of
the Supporting Information) (the adenylylate nucleotide in the
reaction mixtures is a ligand of PII19 and is required for the
interaction of PII with UTase/UR). Also, inhibition of the UT
activity by glutamine was normal when AMP-PNP replaced
ATP in the reaction mixtures (Figure S6 of the Supporting
Information). Therefore, by replacing ATP with AMP-PNP, we
could modestly elevate the UR activity while retaining good
regulation of the UT activity of the systems. We examined
reconstituted UTase/UR-PII monocycles containing AMPPNP in place of ATP, again using a PII concentration of 36
μM and an enzyme concentration of 1.2 μM so that the
substrate:enzyme ratio was again 90:1 (Figure 2D). Under
these conditions, we obtained results that were quite similar to
those obtained when the systems contained ATP; that is, the
system containing the wild-type enzyme displayed good
regulation by glutamine, whereas the system containing the
His-tagged (UQ5516) enzyme had elevated levels of PII
modification at 10 mM glutamine (Figure 2D). The His-tagged
enzyme prepared from strain SA1 was also examined side by
side in this experiment, and the results were essentially the
same as for the enzyme purified from strain UQ5516 (not
shown). These results showed that a modest increase in the UR
activity had little effect in systems containing either the wildtype or His-tagged enzymes and provided a clue that a major
factor in controlling the PII modification state was the
inhibition of the powerful UT activity by glutamine.
A Combination of His-Tagged UTase/UR and an
Altered Form of the Enzyme Displaying Only UR
Activity Effectively Regulated the PII Uridylylation
State in Response to Glutamine. Our conclusion from
the experiment shown in Figure 2D was that a modest increase
in UR activity (caused by inclusion of AMP-PNP in the
reaction mixtures) was not sufficient to allow changes in the
glutamine concentration to bring about broad changes in the
steady-state levels of PII modification when the enzyme bore a
His tag. We next examined whether a larger increase in the level
of UR activity in the reaction mixtures might allow effective
glutamine signaling. To test this, we used an altered form of
UTase/UR containing the D107N mutation, constructed and
purified as described in Materials and Methods. This altered
enzyme is similar to previously described altered versions of
UTase/UR containing different D107 substitutions,13 except
that it does not contain a His tag. The D107 residue is one of
the two critical Mg2+-chelating aspartate residues of the

UTase/UR, addition of glutamine resulted in an immediate
decrease in the level of PII uridylylation and the system
approached the steady state characteristic of the final glutamine
concentration and conditions (Figure 1C). This experiment
was repeated with three independent preparations of wild-type
UTase/UR with similar results (Figure S4B of the Supporting
Information). By contrast, when the system contained Histagged UTase/UR (SA1), the addition of glutamine was
essentially without effect and the PII uridylylation-state level
remained high (Figure 1C). This experiment was repeated on
another occasion with a similar result. Together, the experiments in Figure 1 indicated that the His-tagged enzymes
displayed a severe defect in glutamine signaling when used in
reconstituted covalent modification cycles, particularly when
the PII was present at a relatively high concentration of 3 or 36
μM.
Additional side-by-side experiments were used to compare
the wild-type and His-tagged enzymes in reconstituted covalent
modification cycles at different PII and enzyme concentrations,
and in the presence or absence of 10 mM glutamine. In Figure
2, we show a series of experiments in which the wild-type
enzyme and the His-tagged (UQ5516) enzyme were examined
at a fixed ratio of PII subunits to enzyme active sites of 90:1.
Although for the sake of clarity the data are presented in
separate panels for the wild-type enzyme (Figure 2A) and the
His-tagged (UQ5516) enzyme (Figure 2B), the experiments
were performed side by side for both enzymes for each PII
concentration; in addition, all experiments with the exception
of those using 3 μM PII were also performed side by side with
the SA1 His-tagged preparation, and those data are not shown
only because they are quite similar to the data for the Histagged enzyme prepared from UQ5516. As shown in Figure 2A,
the wild-type system was robust to changes in the PII
concentration when the ratio of substrate to enzyme was held
constant. By contrast, the system containing the His-tagged
enzyme was not robust to PII concentration over the same
range (Figure 2B), even though the ratio of substrate to enzyme
was held constant. At high PII concentrations, the systems with
the His-tagged enzymes were unable to maintain a low level of
PII modification in the presence of 10 mM glutamine (shown
for UQ5516 in Figure 2B). Another consistent, but less
dramatic, result was that for all three enzyme samples (wild
type, UQ5516, and SA1), a slightly higher PII uridylylationstate level was obtained in the presence of glutamine when the
PII concentration was 0.2 μM, relative to that obtained when
the PII concentration was 0.5 μM [shown for wild-type and
His-tagged UTase/UR (UQ5516) in Figure 2].
In another side-by-side comparison, we examined systems
that contained 36 μM PII and 1.2 μM wild-type or His-tagged
(UQ5516) enzyme, or a combination of both enzymes at 1.2
μM each, with or without 10 mM glutamine (Figure 2C).
Again, the wild-type system displayed an excellent response to
glutamine, whereas the system containing the His-tagged
(UQ5516) enzyme displayed elevated levels of PII modification
at 10 mM glutamine. The system containing both enzymes
produced a level of PII-UMP at 10 mM glutamine that was
intermediate between the levels obtained with either of the two
enzymes. This suggested that neither enzyme preparation
contained an activator or inhibitor but rather that the enzyme
catalytic rates were balanced against one another.
The results described so far could have been explained by a
deficiency in the UR activity of the His-tagged enzyme, by a
defect in activation of the UR activity by glutamine, or by a
9037

dx.doi.org/10.1021/bi3005736 | Biochemistry 2012, 51, 9032−9044

Biochemistry

Article

Figure 3. Combination of His-tagged UTase/UR and an altered form of the enzyme displaying only UR activity effectively regulated PII
uridylylation state in response to glutamine. (A) Steady-state PII uridylylation state in the absence of glutamine (filled bars) and in the presence of
10 mM glutamine (empty bars). The PII concentration was 36 μM; the His-tagged UTase/UR (UQ5516) concentration was 0.5 μM, and the altered
D107N UTase/UR concentration was 0, 0.5, 1, 2, or 3 μM to provide the indicated ratios of enzymes. (B) Glutamine signaling by a reconstituted
UTase/UR-PII cycle containing a combination of His-tagged UTase/UR (UQ5516) (0.5 μM) and the altered D107N UTase/UR (3 μM). The PII
concentration was 36 μM. The value plotted on the y axis was obtained in the absence of glutamine.

Figure 4. Initial rate of PII uridylylation (UT activity) and its regulation by glutamine and UMP. Measurement of the initial rate of PII uridylylation
was as described in Materials and Methods.

conserved NT domain, and the purified D107N enzyme did
not display measurable UT activity. We will characterize the UR
activity of this protein in later sections of this report; as we will
show, this activity and its regulation by glutamine were nearly
the same as for the wild-type enzyme.
We examined the uridylylation state of PII, present at the
high concentration of 36 μM, in the presence and absence of 10
mM glutamine, when His-tagged UTase/UR (UQ5516) was
present at a concentration of 0.5 μM and the D107N altered
enzyme was present at various concentrations (Figure 3A).
When the His-tagged (UQ5516) enzyme was the only enzyme
present, the PII uridylylation state only varied over a narrow
range, consistent with the results shown in Figures 1A and 2B,
but the combination of the His-tagged UTase/UR and the
altered D107N enzyme resulted in more effective glutamine

signaling (Figure 3A). When the D107N enzyme was present at
a concentration of 3 μM in combination with the His-tagged
UTase/UR at a concentration of 0.5 μM (such that the
D107N:His-tagged enzyme ratio was 6:1), the PII uridylylation
state varied from 2.9 in the absence of glutamine to 0.21 in the
presence of 10 mM glutamine, for a range of ∼2.7, as typically
seen with wild-type (untagged) UTase/UR (Figure 1A). When
the steady-state responses to a wide range of glutamine
concentrations were examined under these conditions, very
effective glutamine signaling was observed (Figure 3B),
reminiscent of the glutamine signaling by the wild-type
(untagged) enzyme under similar conditions (Figure 1A).
Thus, in practice, the signaling defect of the His-tagged UTase/
UR enzyme could be offset simply by addition of the
9038

dx.doi.org/10.1021/bi3005736 | Biochemistry 2012, 51, 9032−9044

Biochemistry

Article

glutamine regulation of the wild-type enzyme was sharper than
that obtained with the His-tagged enzyme preparation; the level
of inhibition of the wild-type activity was 59.8%, while the
UQ5516 preparation was inhibited 40.2% and the SA1 enzyme
preparation 33.6% (Figure 4B). Together, the results in Figure
4 show that the His-tagged enzymes had a significant defect in
glutamine regulation of the UT activity when the PII
concentration was 36 μM.
In another set of side-by-side experiments, the glutamine
regulation of the UT activity of the wild-type and His-tagged
(UQ5516) enzymes was examined in experiments where the
PII concentration was 5 μM and the enzyme concentration was
0.05 μM (Figure 5). Under these conditions, the difference in

monofunctional D107N enzyme that provided additional UR
activity (Figure 3B).
UT Activity of the His-Tagged Enzymes. A series of
preliminary experiments indicated that both preparations of
His-tagged but otherwise wild-type UTase/UR had normal
levels of UT activity, which was regulated by glutamine, and
displayed Km values for PII and substrate inhibition by PII
similar to those of the wild-type enzyme (Figure S7A of the
Supporting Information).15 The His-tagged enzyme preparations displayed a slightly higher inhibition constant for
glutamine (0.14 mM) than did the wild-type enzyme (0.06
mM), as shown for the wild-type and UQ5516 enzyme
preparations in Figure S7B of the Supporting Information.
Notably, inhibition of the UT activity His-tagged enzyme was
incomplete at 10 mM Gln, whereas the wild-type enzyme was
almost completely inhibited at this glutamine concentration
(Figure S7B of the Supporting Information).
In Figure 4, we show side-by-side comparisons of the wildtype and His-tagged enzymes under various conditions to
highlight the similarities and differences of these enzymes. For
all three enzyme samples, we measured the initial rate of PII
uridylylation (UT activity) in the presence and absence of 10
mM glutamine with 36 μM PII. Because the UT activity is
inhibited by glutamine, the experiments conducted in the
presence of glutamine utilized elevated levels of enzyme to
obtain easily measurable catalytic rates, as shown in Figure 4.
This procedure was used because we verified that the kcat of the
UT reaction was largely independent of the enzyme
concentration, as long as the PII substrate concentration was
saturating (Figure S2 of the Supporting Information). We also
measured the UT activity when the PII concentration was 5 μM
and glutamine was absent to allow comparison with the rates
obtained at 36 μM PII and an assessment of PII substrate
inhibition (Figure 4).
When the PII concentration was 36 μM, the UT activity of
wild-type UTase/UR was regulated ∼97.2-fold by glutamine
(Figure 4). The enzyme displayed substrate inhibition by PII in
the absence of glutamine, as the catalytic rate was faster with 5
μM PII than it was with 36 μM PII. The estimate of 97.2-fold
regulation from Figure 4 was determined as follows: when the
PII concentration was 36 μM, an enzyme concentration of 0.02
μM provided a rate of 1.23 μM min−1 in the absence of
glutamine (corresponding to a kcat of 61.5 min−1) and an
enzyme concentration of 1 μM provided a rate of 0.663 μM/
min in the presence of 10 mM glutamine (corresponding to a
kcat of 0.633 min−1). Thus, glutamine lowered the kcat 97.2-fold.
In contrast to the wild-type enzyme, the His-tagged UTase/
UR preparations (SA1 and UQ5516) were regulated only 18and 23-fold, respectively, by 10 mM glutamine (Figure 4A).
Thus, when the PII concentration was 36 μM, 0.2 μM enzyme
provided approximately half the activity when glutamine was
present than did the enzyme at 0.02 μM in the absence of
glutamine (Figure 4A). These results show that the His-tagged
enzyme preparations had a significant defect in glutamine
inhibition of the UT activity. In the absence of glutamine, the
UT activities of the His-tagged enzymes were similar to that of
the wild type, but in the presence of glutamine, the UT activity
of the His-tagged enzymes was dramatically higher (Figure 4A).
To allow the accurate assessment of the glutamine regulation
of these enzyme samples at fixed enzyme levels, we examined
the effect of 0.1 mM glutamine on the initial rate of
uridylylation when the PII concentration was 36 μM and the
enzyme concentration was 0.05 μM (Figure 4B). As shown,

Figure 5. Initial rate of PII uridylylation and its regulation by
glutamine and UMP. The initial rate of PII uridylylation was measured
as described in Materials and Methods, with 5 μM PII. The His-tagged
enzyme used in this experiment was the UQ5516 preparation.

glutamine regulation of the enzymes was discernible but was
less dramatic; the wild-type enzyme was regulated 87-fold by 10
mM glutamine, while the His-tagged UQ5516 enzyme
preparation was regulated 33-fold by 10 mM glutamine (Figure
5). Similar subtle differences were observed in the regulation by
lower concentrations of glutamine under these conditions
(Figure 5). For example, when the glutamine concentration was
0.1 mM, the wild-type enzyme was inhibited 61% while the
His-tagged UQ5516 enzyme was inhibited 58.3% (Figure 5).
This side-by-side comparison was repeated on another
occasion; the wild-type enzyme was inhibited 59.9% by 0.1
mM glutamine, while the His-tagged UQ5516 enzyme was
inhibited 57.4% by 0.1 mM glutamine. We conclude that when
the PII concentration was 5 μM, glutamine regulation of the
wild-type and His-tagged enzymes was nearly the same. By
comparison, there was an obvious distinction in the glutamine
regulation of the wild-type and His-tagged enzymes when the
PII concentration was 36 μM (Figure 4).
UR Activity of Enzymes. A series of preliminary
experiments using the standard UR assay (Materials and
Methods) indicated that the His-tagged enzymes displayed a
modest defect in catalyzing the deuridylylation of PII-UMP,
relative to that of the wild-type enzyme. In Figure 6A, we
present side-by-side comparisons of the enzymes, in which the
initial rate of PII-UMP deuridylylation was measured in
reaction mixtures that contained ATP as the adenylylate
9039

dx.doi.org/10.1021/bi3005736 | Biochemistry 2012, 51, 9032−9044

Biochemistry

Article

Figure 6. UR activity of wild-type UTase/UR, His-tagged UTase/UR, and altered D107-N UTase/UR, and its regulation by glutamine in systems
containing ATP. (A) Measurements using the standard assay protocol. Initial rates of PII-UMP deuridylylation were determined as described in
Materials and Methods, in experiments where uridylylated PII subunits were initially present at a concentration of 4 μM. Error bars indicate the
standard deviation for duplicate trials, which were performed the next day. (B) Measurements using the TLC-based assay protocol. Initial rates of
PII-UMP deuridylylation were determined as described in Materials and Methods, in experiments where uridylylated PII subunits were initially
present at a concentration of 10.33 μM.

nucleotide and contained 4 μM PII-UMP and 0.2 μM enzyme.
Under these conditions, the wild-type enzyme displayed a basal
UR activity, which was stimulated 3.2-fold by 10 mM
glutamine, as expected.19 The UR activity is weak, and the
stimulated rate for the wild-type enzyme in this experiment
corresponded to ∼2.1 min−1. By comparison, the His-tagged
enzymes displayed a similar basal UR rate, and 2−3-fold
stimulation by 10 mM glutamine (Figure 6). The D107N
enzyme displayed a slightly higher basal UR activity than wildtype UTase/UR, and this rate was stimulated <2-fold by
glutamine; as a result, the stimulated UR rate was slightly lower
than that obtained with the wild-type enzyme (Figure 6A). On
the basis of the data in Figure 6A, it appeared that the Histagged enzymes had an only modest defect in the UR activity.
Because of concerns about the accuracy of the standard UR
assay, we developed an alternative assay procedure incorporating a thin-layer chromatographic separation of the reaction
product (UMP), as described in Materials and Methods.
Although this new assay procedure is labor-intensive, we believe
it allows more accurate estimations of the initial reaction rates,
particularly when higher levels of activity are being measured.
As shown in Figure 6B, the His-tagged enzymes displayed a
significant (∼3-fold) defect in the level of UR activity, while the
D107N enzyme was again quite similar to the wild-type
enzyme. Also, higher UR activities were obtained using the
TLC-based assay method as compared to the standard assay
method (panel A vs panel B of Figure 6).
As noted above, the UR activity is stimulated when the ATP
in the reaction mixtures is replaced with AMP-PNP. We
compared the UR activity of the wild-type and His-tagged
(SA1) enzymes in the presence of AMP-PNP in side-by-side
experiments that were repeated; the His-tagged enzyme
displayed a 5-fold lower level of basal UR activity and a 2.2fold lower level of glutamine-activated UR activity in
comparison to the wild-type enzyme (Figure S8 of the
Supporting Information).

A Hypothesis To Explain PII Substrate Inhibition of UT
Activity, Glutamine Regulation of UT and UR Activities,
and the Effect of Adding a His Tag to UTase/UR on the
Robustness to PII Concentration. UTase/UR is a
monomeric protein, consisting of four functional domains
(depicted schematically in Figure 7).13 By analogy with other

Figure 7. Schematic depiction of the domain arrangement of UTase/
UR and the sites from which UMP and PII exert their inhibitory
effects. The N-terminal NT domain of UTase/UR is depicted as a gray
circle and the central HD domain of UTase/UR as a gray rectangle,
and the tandem C-terminal ACT domains of UTase/UR are depicted
as gray diamonds. PII, depicted as a blue triangle, binds to the NT
domain at the site where it is uridylylated (substrate site) and binds to
the HD domain at the site where it is formed from PII-UMP (product
site). UMP is also a product of the UR activity of the HD domain.

proteins containing ACT domains, it is likely that binding of
glutamine to the tandem ACT domains at the C-terminal end
of the protein is responsible for inhibition of the UT activity
and stimulation of the UR activity. Alterations of the ACT
domains block glutamine regulation of the UT and UR
activities.13 Because the UT activity is tightly regulated by
glutamine, we hypothesize that the HD domain is not only
responsible for catalysis of the UR activity but also responsible
for controlling the UT activity in response to glutamine
binding. That is, the HD domain has a signal transduction
9040

dx.doi.org/10.1021/bi3005736 | Biochemistry 2012, 51, 9032−9044

Biochemistry

Article

the absence of glutamine regulation of the UT activity resulting
from the small deletion within the HD domain as reflecting a
loss of the signal transduction function of the HD domain.
Amino Acid Substitutions of the Catalytic Residues
within the HD Domain Eliminated Substrate Inhibition
of UT Activity by PII and Partially Restored Glutamine
Regulation of UT Activity. The HD-AA (UQ5628) and HDQN (UQ5629) proteins are His-tagged enzymes that contain
amino acid substitutions at the conserved H and D residues of
the HD domain.13 These proteins lack UR activity but display
considerable UT activity, which was regulated by glutamine13
(see below). We observed that these proteins displayed better
regulation of UT activity by glutamine than did the His-tagged
but otherwise wild-type versions of UTase/UR (Figure 9).
When the PII concentration was 36 μM and UMP was absent,
each of these proteins displayed 42-fold regulation of UT
activity by glutamine (Figure 9). That is, when glutamine was
absent and the enzyme concentration was 0.02 μM, the activity
was more than 4-fold higher than when glutamine was present
and the enzyme concentration was 0.2 μM. When the PII
concentration was 5 μM, the HD-AA protein displayed 59-fold
regulation by glutamine and the HD-QN protein displayed 85fold regulation by glutamine. In additional experiments, we also
observed that these two His-tagged proteins with HD domain
alterations displayed better regulation than did the His-tagged
but otherwise wild-type UTase/UR when glutamine was
present at a low concentration of 0.1 mM. Thus, remarkably,
alterations within the HD domain partially compensated for the
presence of the His tag in allowing strong glutamine control of
UT activity. Neither the HD-AA protein nor the HD-QN
protein displayed substrate inhibition of UT activity by PII
(Figure 9), which is consistent with our hypothesis.
A Reconstituted UTase/UR-PII Monocycle Comprised
of Monofunctional UTase and UR Enzymes. Because the
HD-AA protein lacked UR activity, we used this protein along
with the D107N monofunctional UR enzyme to produce a
reconstituted UTase/UR-PII cycle comprised of two monofunctional enzymes. The altered HD-AA protein lacked
substrate inhibition by PII, and its UT activity was wellregulated by glutamine even when the PII concentration was
high; we therefore expected that a monocycle containing the
monofunctional HD-AA and D107N enzymes should be robust
to PII concentration. To examine this, we held the PII
concentration fixed at 36 μM and examined the effect of
combining 0.8 μM HD-AA enzyme with various concentrations
of the D107N enzyme. The steady-state uridylylation of PII was
assessed in systems lacking glutamine or containing 10 mM
glutamine, to discern the range of uridylylation states that could
be obtained in response to glutamine (Figure 10). As shown,
the largest range of uridylylation states in response to glutamine
signaling was obtained in this experiment when the ratio of
D107N to HD-AA was 5. Below this ratio, a narrow range of
uridylylation states was obtained, biased toward higher
uridylylation states, while at a higher ratio of enzymes, a
narrow range of uridylylation states was obtained that was
biased toward lower uridylylation states (Figure 10A). We
therefore explored using a modest excess of the D107N
enzyme, relative to the HD-AA enzyme in reconstituted
monocycles, and in additional experiments found that a 4:1
ratio of the two enzymes gave the optimal responsiveness to
glutamine. The results of using a 4:1 D107N:HD-AA ratio in a
reconstituted UTase/UR-PII monocycle are shown in Figure
10B. A PII concentration of 36 μM was used, and unlike the

function. The only other possible mechanisms for regulation of
the UT activity by binding of glutamine to the ACT domains
would be for the ACT domains to contact the N-terminal UT
domain directly, such as if the protein had an overall curvature
or formed an oligomer in which the ACT domains of one
subunit were in contact with the NT domain of the opposing
subunit. Both of these possibilities seem less likely than if the
signal of glutamine binding is passed to the NT (UT) domain
by the UR domain. Earlier studies with the related ATase
enzyme that reversibly modifies GS showed that in that protein
the two catalytic domains regulated each other and had both
catalytic and signal transducing functions,19,20 as we hypothesize for UTase/UR.
Because PII is a product of the UR reaction catalyzed by the
central HD domain and is the substrate of the UT activity of
the NT domain, there are two binding sites on UTase/UR for
PII (Figure 7). We hypothesize that PII exerts substrate
inhibition of the UT activity upon binding to its site in the HD
domain. We also hypothesize that the unusual properties of
His-tagged UTase/UR resulted from an abnormal interaction
between the N-terminal nucleotidyltransferase (NT) domain
and the central HD domain. Because of this abnormal domain
arrangement, the binding of PII to the HD domain (the
substrate inhibition site) interferes with the transmission of the
glutamine signal from the ACT domains to the NT domain and
weakens the inhibition of the UT activity by glutamine.
A Small Deletion within the HD Domain Eliminated
Glutamine Regulation of UT Activity and Also Eliminated Substrate Inhibition of UT Activity by PII. If the
PII-mediated substrate inhibition of UT activity was due to
binding of PII to the UR active site within the HD domain of
UTase/UR, then mutations that alter the UR active site are
predicted to eliminate substrate inhibition. The Δ-HD protein
(purified from strain UQ5627)12 is a His-tagged protein in
which 22 residues have been removed by a deletion within the
HD domain (Δ-A510−D531), and this protein lacks UR
activity.13 This protein displayed fairly weak UT activity, and
this activity was not regulated by glutamine13 (Figure 8).
Consistent with our hypothesis, the UT activity of the Δ-HD
protein did not display substrate inhibition by PII. We interpret

Figure 8. UT activity of the His-tagged Δ-HD (UQ5627) protein.
Initial rates of PII uridylylation were determined as described in
Materials and Methods.
9041

dx.doi.org/10.1021/bi3005736 | Biochemistry 2012, 51, 9032−9044

Biochemistry

Article

Figure 9. UT activity of the His-tagged HD-AA (UQ5628) and HD-QN (UQ5629) proteins. Initial rates of PII uridylylation were determined as
described in Materials and Methods.

Figure 10. Reconstituted UTase/UR-PII cycles containing mixtures of the monofunctional altered HD-AA UTase/UR and D107N UTase/UR. (A)
Steady-state PII uridylylation state in the absence of glutamine (filled bars) and in the presence of 10 mM glutamine (empty bars). The PII
concentration was 36 μM; the His-tagged altered HD-AA UTase/UR concentration was 0.8 μM, and the altered D107N UTase/UR concentration
was 0.8, 2.4, 4, 5.6, or 7.2 μM to provide the indicated enzyme ratios. (B) Glutamine signaling by reconstituted UTase/UR-PII cycles containing a
combination of enzymes. The PII concentration was at 36 μM in all reaction mixtures: (■) reaction mixtures containingd 0.5 μM His-tagged HD-AA
UTase/UR and 2 μM D107N UTase/UR and (●) reaction mixtures containing 0.5 μM His-tagged UTase/UR (UQ5516) and 2 μM D107N
UTase/UR. The values plotted on the y axis were obtained in the absence of glutamine.

situation when the His-tagged bifunctional UTase/UR was
used, a wide range of PII uridylylation states (∼2.68 of 3.0)
signaled changes in the glutamine concentration (Figure 10B).
Thus, the reconstituted system comprised of monofunctional
enzymes (Figure 10B) was not defective in signaling when the
PII concentration was 36 μM, in contrast to the results
obtained with the His-tagged bifunctional enzyme (Figure 1A).
In the same experiment, we also examined the performance of a
reconstituted UTase/UR-PII cycle containing the D107N and
His-tagged but otherwise wild-type UTase/UR (UQ5516),
using a 4:1 ratio of D107N to His-tagged UTase/UR
(UQ5516). As shown in Figure 10B, a wide range of
uridylylation states was also obtained (2.65 of 3.0) in this
system, but other features of the glutamine response differed in
the two reconstituted cycles (Figure 10B). The steepness of the
response was greater in the system containing His-tagged
UTase/UR (UQ5516) than in the system containing His-

tagged HD-AA altered UTase/UR, and the midpoint of the
glutamine response was at a higher glutamine concentration.
Because the His-tagged but otherwise wild-type UTase/UR
demonstrated PII substrate inhibition of UT activity, while the
HD-AA enzyme did not demonstrate substrate PII inhibition of
UT activity, these results may point to a role of PII substrate
inhibition in determining the sensitivity of the glutamine
response of the cycle.16

■

DISCUSSION
The addition of various “tags” to proteins to allow the use of
common affinity chromatography steps in their purification has
greatly advanced the analysis of numerous enzymes, but this
procedure is not without risk because the tagged form of the
enzyme may display altered properties. Here, we show that the
addition of an N-terminal His tag to UTase/UR resulted in an
altered enzyme that was defective in glutamine signaling when
9042

dx.doi.org/10.1021/bi3005736 | Biochemistry 2012, 51, 9032−9044

Biochemistry

Article

(Figure 4). Our hypothesis to explain these observations is that,
for the His-tagged enzyme, when PII bound to the HD domain
it interfered with the passage of the glutamine signal to the Nterminal NT domain.
We observed that both the His-tagged (but otherwise wildtype) UTase/UR and the His-tagged HD-AA monofunctional
(UTase only) enzyme could be combined with the monofunctional (UR-only) D107N altered enzyme to produce
reconstituted covalent modification cycles that responded well
to glutamine at the high PII concentration of 36 μM. Thus, the
robustness defect of His-tagged UTase/UR could be offset
simply by an increase in glutamine-regulated UR activity. This
shows that the relative levels of the antagonistic activities play a
key role in allowing a wide range of PII modification states in
response to glutamine signaling and is consistent with
theoretical studies of a covalent modification cycle.21 We
observed a defect of His-tagged UTase/UR in the regulation of
UT activity by glutamine that became evident as the PII
concentration was increased, but other types of defects could
likely result in a similar reduction in the level of PII
modification states in response to glutamine, such as simple
defects in either catalytic activity. Furthermore, if an enzyme
had a defect in catalysis, this could perhaps be offset by
enhanced glutamine regulation of an activity so as to restore the
normal relative level of the two antagonistic enzyme activities.
That is, the relative levels of the UT and UR activities are likely
to determine the range of modification states in response to
glutamine, as predicted,21 and a variety of mechanisms may
alter or restore the natural relative levels of the activities.
Interestingly, when we compared reconstituted cycles that
contained His-tagged UTase/UR and the HD-AA altered
UTase/UR in combination with the D107N altered enzyme, we
observed that cycles containing the His-tagged but otherwise
wild-type enzyme had a steeper response to glutamine than did
cycles containing the HD-AA protein (Figure 10B). Although
further studies will be necessary, this finding suggests that PII
substrate inhibition of UT activity may play a role in increasing
the sensitivity (apparent kinetic order, Hill coefficient) of
glutamine responses of the cycle. The ability of substrate
inhibition to increase the sensitivity of responses of a covalent
modification cycle was demonstrated by Guidi and Goldbeter.16
One general conclusion from our study is that the robustness
of the covalent modification cycle to the concentration of its
substrate depended critically on the catalytic rates of the
antagonistic converter enzymes and their regulation, consistent
with theory.21 Depending on the parameters of the system, a
fairly modest defect in regulation of an activity can bring about
a dramatic change in the steady-state responses of the covalent
modification cycle and eliminate robustness to substrate
concentration. Another important observation from our study
is that a loss of robustness to the concentration of the cycle
substrate was manifested by a diminished range of modification
states in response to the stimulatory effector. We hypothesize
that this may be a common manifestation of the loss of
robustness to substrate concentration.

used in reconstituted covalent modification cycles. Specifically,
the His-tagged enzyme displayed a defect in glutamine signaling
when the PII concentration was high but displayed only a
modest defect in glutamine signaling when the PII concentration was low. That is, the robustness of the covalent
modification cycle to changes in PII concentration was lost as a
result of the addition of a His tag to the enzyme. When the PII
concentration was high, a limited range of PII uridylylation
states were obtained as the glutamine concentration was varied,
and these were biased toward high states of uridylylation. This
defect was readily evident in side-by-side experiments where the
ratio of substrate to enzyme was held constant (Figure 2); thus,
it became clear that the PII concentration was the important
parameter to which robustness was lost. The fortuitous
observation of a defect in the robustness of the system to PII
concentration allowed us to study the phenomenon and
examine the underlying biochemical mechanism.
Prior studies have shown that UTase/UR consists of three
functional elements: an N-terminal NT domain that catalyzes
UT activity, a central HD domain that catalyzes UR activity,
and a pair of tandem ACT domains at the C-terminus of the
protein that is responsible for glutamine sensation.12 ACT
domains are commonly found in a tandem, paired, arrangement, so the two ACT domains may comprise a functional unit
responsible for passing the glutamine signal to the other
domains. We hypothesize that the domains of UTase/UR
interact with and regulate their neighboring domains, and that
the C-terminal glutamine-sensing ACT domains do not directly
regulate the N-terminal NT domain but, rather, must pass their
signal indirectly, through the central HD domain, to control the
UT activity of the NT domain (Figure 7). A key to
understanding the effect of PII concentration on the enzyme
is the observation of PII substrate inhibition of UT activity.15
Substrate inhibition results from the substrate binding to not
only the catalytic site of an enzyme but also another site from
which inhibition occurs. In the case of the UTase/UR enzyme,
substrate inhibition by PII is very likely to reflect binding of PII
to both the catalytic site in the N-terminal UT domain and a
site in the central HD domain. PII is a product of the UR
activity; thus, there is certainly a PII binding site in the HD
domain. We observed that the UT activity of the His-tagged
enzymes was subject to substrate inhibition by PII; thus, it
seems likely that PII binds normally to the site in the HD
domain in these enzymes. We also observed that altered
enzymes with either a small deletion within the HD domain or
two point mutations within the HD domain lacked substrate
inhibition of UT activity by PII, and that the regulation of UT
activity by glutamine was altered by mutations in the HD
domain. These observations are consistent with binding of PII
to the HD domain being the source of substrate inhibition, and
with the HD domain having a role in passing the glutamine
signal from the ACT domains to the UT domain.
We hypothesize that the presence of the His tag resulted in a
subtle alteration of the interactions between the N-terminal
nucleotidyltransferase (UTase) domain and the central HD
(UR) domain. As long as PII was present at a low
concentration, such that there was little occupancy of the HD
domain site from which PII exerts substrate inhibition of the
UT activity, glutamine regulation of UT activity of the Histagged enzyme was nearly normal (Figure 5). However, at high
PII concentrations, where PII occupied both the N-terminal
catalytic site and the HD domain PII-binding site, glutamine
signaling by the His-tagged enzyme was clearly defective

■

ASSOCIATED CONTENT

* Supporting Information
S

Eight additional figures. This material is available free of charge
via the Internet at http://pubs.acs.org.
9043

dx.doi.org/10.1021/bi3005736 | Biochemistry 2012, 51, 9032−9044

Biochemistry

■

Article

(16) Schauder, B., Blocker, H., Frank, R., and McCarthy, J. E. (1987)
Inducible expression vectors incorporating the E. coli atpE translational
initiation region. Gene 52, 279−283.
(17) Jiang, P., and Ninfa, A. J. (2012) Characterization of the
Reconstituted UTase/UR-PII-NRII-NRI Bicyclic Signal Transduction
System that Controls the Transcription of Nitrogen-Regulated (Ntr)
Genes. Biochemistry, DOI: 10.1021/bi300575j.
(18) Guidi, G. M., Carlier, M. F., and Goldbeter, A. (1998) Bistability
in the isocitrate dehydrogenase reaction: An experimentally based
theoretical study. Biophys. J. 74, 1229−1240.
(19) Kamberov, E. S., Atkinson, M. R., and Ninfa, A. J. (1995) The
Escherichia coli PII signal transduction protein is activated upon
binding 2-ketoglutarate and ATP. J. Biol. Chem. 270, 17797−17807.
(20) Jiang, P., Mayo, A. E., and Ninfa, A. J. (2007) Escherichia coli
glutamine synthetase adenylyltransferase (ATase, E.C. 2.7.7.49):
Kinetic characterization of regulation by PII, PII-UMP, glutamine,
and α-ketoglutarate. Biochemistry 46, 4133−4146.
(21) Jiang, P., Pioszak, A. A., and Ninfa, A. J. (2007) Structure/
function analysis of glutamine synthetase adenylyltransferase (ATase,
E.C. 2.7.7.49) of Escherichia coli. Biochemistry 46, 4117−4132.
(22) Stadtman, E. R., and Chock, P. B. (1977) Superiority of
interconvertable enzyme cascades in metabolic regulation: Analysis of
monocyclic systems. Proc. Natl. Acad. Sci. U.S.A. 74, 2761−2765.

AUTHOR INFORMATION

Corresponding Author

*E-mail: aninfa@umich.edu. Phone: (810) 360-3378, (734)
763-8065.
Present Address
§

Great Lakes Bioenergy Research Center, University of
WisconsinMadison, Madison, WI 53706.

Funding

Y.Z. was supported by National Institutes of Health Grant
GM65891 to Gary Roberts.
Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS

■

REFERENCES

We thank Gary Roberts for sharing information and materials
and for helpful comments on the work and the manuscript.

(1) Savageau, M. A. (1971) Parameter sensitivity as a criterion for
evaluating and comparing the performance of biochemical systems.
Nature 229, 542−544.
(2) Kitano, H. (2007) Towards a theory of biological robustness.
Mol. Syst. Biol. 3, 137.
(3) Alon, U., Surette, M. G., Barkai, N., and Leibler, S. (1999)
Robustness in bacterial chemotaxis. Nature 397, 168−171.
(4) Shinar, G., Milo, R., Martinez, M. R. T., and Alon, U. (2007)
Input-output robustness in simple bacterial signaling systems. Proc.
Natl. Acad. Sci. U.S.A. 104, 19931−19935.
(5) Soyer, O. S., and Pfeiffer, T. (2010) Evolution under fluctuating
environments explains observed robustness in metabolic netwoorks.
PLoS Comput. Biol. 6, e10000907.
(6) Chock, P. B., and Stadtman, E. R. (1977) Superiority of
interconvertable enzyme cascades in metabolic regulation: Analysis of
multicyclic systems. Proc. Natl. Acad. Sci. U.S.A. 74, 2766−2770.
(7) Gomez-Uribe, C., Verghese, G. C., and Mirny, L. A. (2007)
Operating regimes of signaling cycles: Statics, dynamics, and noise
filtering. PLoS Comput. Biol. 3, e246.
(8) Cardenas, M. L., and Cornish-Bowden, A. (1989) Characteristics
necessary for an interconvertible enzyme cascade to generate a highly
sensitive response to an effector. Biochem. J. 257, 339−345.
(9) Goldbeter, A., and Koshland, D. E. (1981) An amplified
sensitivity arising from covalent modification in biological systems.
Proc. Natl. Acad. Sci. U.S.A. 78, 6840−6844.
(10) Koshland, D. E., J.r, Goldbeter, A., and Stock, J. B. (1982)
Amplification and adaptation in regulatory and sensory systems.
Science 217, 220−225.
(11) Ninfa, A. J., Jiang, P., Atkinson, M. R., and Peliska, J. A. (2000)
Integration of antagonistic signals in the regulation of nitrogen
assimilation in Escherichia coli. Curr. Top. Cell. Regul. 36, 31−75.
(12) Jiang, P., Peliska, J. A., and Ninfa, A. J. (1998) Enzymological
characterization of the signal-transducing uridylyltransferase/uridylylremoving enzyme (EC 2.7.7.59) of Escherichia coli and its interaction
with the PII proteins. Biochemistry 37, 12782−12794.
(13) Zhang, Y., Pohlmann, E. L., Conrad, M. C., and Roberts, G. P.
(2010) Mutagenesis and functional characterization of the four
domains of GlnD, a bifunctional nitrogen sensor protein. J. Bacteriol.
192, 2711−2721.
(14) Ventura, A. C., Jiang, P., Van Wassenhove, L., Del Vecchio, D.,
Merajver, S. D., and Ninfa, A. J. (2010) Signaling properties of a
covalent modification cycle are altered by a downstream target. Proc.
Natl. Acad. Sci. U.S.A. 107, 10032−10037.
(15) Kamberov, E. S., Atkinson, M. R., Chandran, P., Feng, J., and
Ninfa, A. J. (1994) Sensory components controlling bacterial nitrogen
assimilation. Cell. Mol. Biol. Res. 40, 175−191.
9044

dx.doi.org/10.1021/bi3005736 | Biochemistry 2012, 51, 9032−9044